Journal: iScience

Article Title: Fibrinogen triggers perivascular fibroblast activation in a mouse model of cortical ischemic stroke

doi: 10.1016/j.isci.2025.113834

Figure Lengend Snippet: Fibrinogen deposition precedes PVF activation in the perivascular space after cortical injury (A) Representative image of GFP (green) in collagen1α1-EGFP mice in the lesion core 6 days after PT ( n = 4 mice). Scale bar, 400 μm. (B) Representative image of fibrinogen (red) and GFP (green) in the lesion core 1 day after PT ( n = 3 mice). White dashed box (ii) indicate the enlargement of a vessel area presented in D. Scale bar, 400 μm. (C) Quantification of fibrinogen- (left) and GFP- (right) immunoreactivity (IR) in the lesion core per area ( n = 4 mice, uninjured, PT D3, PT D6; n = 3 mice, PT D1). ∗∗∗ p < 0.001 by one-way ANOVA. (D) Representative images of fibrinogen (red), GFP (green) and pan-laminin (gray) in the vasculature of the lesion core 1 day after PT compared to uninjured brain. White dashed boxes (i’, ii’) indicate enlargement of vessel areas presented in E. Scale bar, 10 μm. (E) 3D reconstruction of the cortical vasculature 1 day after PT showing fibrinogen deposition (white star) in the perivascular space (yellow), compared to the uninjured brain. Scale bar, 5 μm. (F) Quantification of fibrinogen and pan-laminin colocalization in the perivascular space ( n = 3 mice; 18 vessel areas, uninjured; 23 vessel areas, PT D1; 25 vessel areas, PT D3; 71 vessel areas, PT D6). ∗∗ p < 0.01 by one-way ANOVA; ∗∗∗∗ p < 0.0001 by one-way ANOVA. (G) 3D reconstruction of GFP+ cells in the perivascular space in the lesion core of mice 3 days after PT, compared to uninjured mice. Scale bar, 10 μm. Quantification of GFP+ cell volume ( n = 3 mice, 36 cells). ∗∗∗∗ p < 0.0001 by Mann-Whitney U test. (H) Representative images of collagen1 α 1 (red) in combination with GFP (green) in the perivascular space in the lesion core of collagen1α2-cre ERT2 :Rosa26-EYFP mice 3 days after PT, compared to uninjured mice. Scale bars, 10 μm (overviews), 5 μm (magnifications). Quantification of collagen1α1–IR per GFP+ area ( n = 4 mice, uninjured; n = 5 mice, PT D3). ∗ p < 0.05 by Mann-Whitney U test. (I) Representative images of periostin (red) in combination with GFP (green) in the perivascular space in the lesion core of collagen1α2-cre ERT2 :Rosa26-EYFP mice 3 days after PT, compared to uninjured mice. Scale bars, 10 μm (overviews), 5 μm (magnifications). Quantification of periostin-IR per GFP+ area ( n = 4 mice, uninjured; n = 5 mice, PT D3). ∗ p < 0.05 by Mann-Whitney U test. All data are shown as mean ± s.e.m. See also and .

Article Snippet: Collagen1α1 reverse primer: 5′ ACCACTTGATCCAGAAGGACCTT 3′ , Eurofins , N/A.

Techniques: Activation Assay, MANN-WHITNEY

Journal: iScience

Article Title: Fibrinogen triggers perivascular fibroblast activation in a mouse model of cortical ischemic stroke

doi: 10.1016/j.isci.2025.113834

Figure Lengend Snippet: Fibrinogen deficiency reduces PVF activation after PT (A) Experimental setup for photothrombosis (PT) on fibrinogen-depleted (ancrod) and NaCl-treated (control) collagen1α1-EGFP mice. Representative images of GFP (green) in the lesion core of fibrinogen-depleted and control mice 6 days after PT. Scale bar, 400 μm. Quantification of GFP-immunoreactivity (IR) in the lesion core per area ( n = 7 mice, control; n = 8 mice, ancrod). ∗∗ p < 0.01 by Student’s t test. (B) Expression of collagen1α1 and periostin mRNA in FACS-isolated GFP+ cells of fibrinogen-depleted and control collagen1α1-EGFP mice 3 days after PT determined by qPCR and normalized to GAPDH ( n = 6 mice, control; n = 5 mice, ancrod). ∗ p < 0.05, ∗∗ p < 0.01 by Mann-Whitney U test. (C) Representative images of collagen1 α 1 (red, left) and periostin (red, right) in combination with GFP (green) in the perivascular space in the lesion core of fibrinogen-depleted and control mice 3 days after PT. Scale bar, 20 μm. Quantification of Collagen1α1- and periostin-IR per GFP+ area ( n = 6 mice). ∗ p < 0.05 by Mann-Whitney U test. (D) 3D reconstruction of GFP+ cells in the perivascular space in the lesion core of fibrinogen-depleted and control mice 3 days after PT. Scale bar, 10 μm. Quantification of GFP+ cell volume ( n = 3 mice; 36 cells, control; 39 cells, ancrod). ∗∗ p < 0.01 by Mann-Whitney U test. (E) 3D reconstruction of GFP (green) and CD31 (red) in the lesion core of fibrinogen-depleted (ancrod) and control mice 6 days after PT, compared to uninjured mice. Yellow arrowheads indicate migratory PVF. Scale bar, 10 μm. Quantification of migratory PVF ( n = 8 mice). ∗∗ p < 0.01, by Student’s t test. Quantification of PVF migration distance away from vasculature ( n = 8 mice; 504 cells, control; 125 cells, ancrod). ∗∗∗ p < 0.001 by Mann-Whitney U test. (F) 3D reconstruction of active β1 integrin (red), and GFP (green) in the lesion core 3 and 6 days after PT, compared to uninjured mice ( n = 3 mice). Scale bar, 10 μm. (G) 3D reconstruction of vinculin (red), and GFP (green) in the lesion core 3 days after PT, compared to uninjured mice. Scale bar, 20 μm. Quantification of vinculin-IR in GFP+ area ( n = 6 mice; 32 cells, control; 49 cells, ancrod). ∗∗∗∗ p < 0.0001 by Mann-Whitney U test. (H) Representative western blot image of collagen1α1 expressed by meningeal fibroblasts pretreated for 1 h with PP2 and treated for 1 day with fibrinogen. PDGF served as a positive control ( n = 4 biological replicates). All data are shown as mean ± s.e.m. See also .

Article Snippet: Collagen1α1 reverse primer: 5′ ACCACTTGATCCAGAAGGACCTT 3′ , Eurofins , N/A.

Techniques: Activation Assay, Control, Expressing, Isolation, MANN-WHITNEY, Migration, Western Blot, Positive Control

Journal: iScience

Article Title: Fibrinogen triggers perivascular fibroblast activation in a mouse model of cortical ischemic stroke

doi: 10.1016/j.isci.2025.113834

Figure Lengend Snippet: Fibrinogen-induced myeloid cells contribute to PVF activation after PT (A) Representative image of CCR2 (magenta) and CD68 (cyan) in the lesion core 6 days after PT ( n = 1 mouse). White dashed boxes (a, b) indicate the enlargement of CCR2+ cells (right). Yellow arrowheads indicate a CCR2+CD68 + cell (right, top) and a CCR2+CD68 – cell (right, bottom). Scale bars, 400 μm (overview), 5 μm (magnifications). (B) 3D reconstruction of CD206 (red) and CD68 (cyan) in the perivascular space in the lesion core 3 days after PT, compared to uninjured mice. Scale bar, 5 μm. Quantification of CD68 volume in CD206 + perivascular macrophages ( n = 2 mice; 19 cells, uninjured; 16 cells, PT D3). ∗∗∗ p < 0.001 by Mann-Whitney U test. (C) Experimental setup for photothrombosis (PT) on myeloid cells-depleted (PLX5622)- and chow-fed (control) mice. Representative images of collagen1α1 (red) in the lesion core in myeloid cell-depleted and control mice 7 days after PT. Scale bar, 400 μm. Quantification of collagen1α1- and periostin-immunoreactivity (IR) in the lesion core per area normalized by the control group ( n = 8 mice). ns, not significant, ∗∗ p < 0.01 by Student’s t test. (D) Representative images of collagen1 α 1 (red, left) and periostin (red, right) in combination with GFP (green) in the perivascular space in the lesion core of collagen1α1-EGFP:Fib γ390–396A mice, compared to collagen1α1-EGFP mice 3 days after PT. Scale bars, 20 μm. Quantification of collagen1α1- and periostin-IR per GFP+ area normalized by the control group ( n = 8 mice, collagen1α1-EGFP ; n = 10 mice, collagen1α1-EGFP:Fib γ390–396A ). ns, not significant and ∗ p < 0.05 by Student’s t test (top) and Mann-Whitney U test (bottom). (E) scRNA-seq of the lesion core after PT and receptor-ligand pair analysis of PVFs and other scar cells. (F) UMAP representation of individual cells from the lesion core in fibrinogen-depleted and control mice 6 days after PT by scRNA-seq. Each dot represents an individual cell. OPC, oligodendrocyte precursor cell. VSMC, vascular smooth muscle cell. (G) Sankey diagram depicting cell interactions between different cell populations in fibrinogen-depleted and control mice 6 days after PT. Thickness of gray lines represents number of interactions. BAM, border-associated macrophage. (H) Dot plot of interaction scores for ligand-receptor pairs between fibroblasts to reactive monocytes or inflammatory macrophages and operating signaling pathways in fibrinogen-depleted and control mice 6 days after PT. Dot size represents the log of the p value of aggregated scores. Dot color represents the ligand-receptor strength score from SCA analysis. ∗ ≥ 0.01 NATMI edge specificity. All data are shown as mean ± s.e.m. See also .

Article Snippet: Collagen1α1 reverse primer: 5′ ACCACTTGATCCAGAAGGACCTT 3′ , Eurofins , N/A.

Techniques: Activation Assay, MANN-WHITNEY, Control, Protein-Protein interactions

Journal: iScience

Article Title: Fibrinogen triggers perivascular fibroblast activation in a mouse model of cortical ischemic stroke

doi: 10.1016/j.isci.2025.113834

Figure Lengend Snippet: Fibrinogen depletion alters PVF-astrocyte interactions and improves neuronal plasticity at the lesion border after PT (A) Dot plot of interaction scores for ligand-receptor pairs between fibroblasts and reactive astrocytes and operating signaling pathways 6 days after PT in ancrod and control mice. (B) 3D reconstruction of collagen1α1 (blue) and GFAP (green) in the lesion border of fibrinogen-depleted (ancrod) and control mice 10 days after PT. White arrows indicate collagen1α1 and GFAP contact. Scale bar, 50 μm. Quantification of collagen1α1-immunoreactivity (IR) in the lesion border ( n = 9 mice, 104 astrocytes, control; 98 astrocytes, ancrod). ∗∗∗∗ p < 0.0001 by Mann-Whitney U test. (C) Representative images of CD44 (red) and GFAP (green) in the lesion border in fibrinogen-depleted and control mice 10 days after PT. Scale bar, 20 μm. Quantification of CD44–IR in the lesion border ( n = 8 mice; 64 astrocytes, control; 62 astrocytes, ancrod). ∗∗∗∗ p < 0.0001 by Mann-Whitney U test. (D) Representative images of CD44 (red), GFAP (green) and GFP (blue) in the lesion border in fibrinogen-depleted and control collagen1α1-EGFP mice 10 days after PT. Stars indicate PVF–CD44+ astrocyte colocalization. Scale bar, 20 μm. (E) Representative images of 5–HT (red) and GFAP (green) at the lesion border area of fibrinogen-depleted and control mice 10 days after PT, followed by 3D reconstruction of images (right). White arrows indicate serotonergic axons. Scale bars, 50 μm (overviews), 20 μm (magnifications). Quantification of serotonergic axons longer than 40 μm at the lesion border area ( n = 10 mice). ∗ p < 0.05 by Mann-Whitney U test. Quantification of serotonergic axons passing the lesion border ( n = 10 mice, control; n = 9 mice, ancrod). ∗ p < 0.05 by Student’s t test. All data are shown as mean ± s.e.m. See also .

Article Snippet: Collagen1α1 reverse primer: 5′ ACCACTTGATCCAGAAGGACCTT 3′ , Eurofins , N/A.

Techniques: Protein-Protein interactions, Control, MANN-WHITNEY